exercism · ErikSchierboom · Sep 26, 2025 · Sep 26, 2025 · Sep 26, 2025 · Nov 27, 2025
diff --git a/.github/workflows/test.yml b/.github/workflows/test.yml
@@ -25,7 +25,7 @@ jobs:
           unzip uiua.zip
           echo "${PWD}" >> "${GITHUB_PATH}"
         env:
-          VERSION: 0.16.0
+          VERSION: 0.17.2
           GH_TOKEN: ${{ github.token }}
 
       - name: Verify all exercises

diff --git a/docs/INSTALLATION.md b/docs/INSTALLATION.md
@@ -4,7 +4,7 @@
 See the [official installation guide][install-guide] for the latest instructions, including IDE integration and fonts.
 
 ```exercism/note
-Currently our online test-runner uses version `0.14.1`.
+Currently our online test-runner uses version `0.17.0`.
 With Uiua's rapid development process, that might be subject to change, so keep this in mind if you can't reproduce the testing results from the website.
 ```
 

diff --git a/exercises/practice/affine-cipher/.meta/example.ua b/exercises/practice/affine-cipher/.meta/example.ua
@@ -1,9 +1,9 @@
 Coprime  ← ¬/↥≡⌕ ∩(°/×)
-MMI      ← ⊗1˜◿×⊃(⋅⇡|⊙∘)
+MMI      ← ˜⨂1˜◿×⊃(⋅⇡|⊙∘)
 Validate ← ⍤"a and m must be coprime" (Coprime :26)
 Groups   ← ⊜(□∘)\+=0◿5°⊏
 Sanitize ← ▽+⊃(⌵±|×⊃(≥@0|≤@9)).¯⌵
 Encrypt  ← ⍜(-@a▽)(◿26+×)⌵±.
 Encode   ← /$"_ _" Groups Encrypt Sanitize ⊃(⊙Validate|⋅∘)
-Decrypt  ← ◿26×⊃(⋅(MMI:26)|-:⊙⋅∘)
+Decrypt  ← ◿26×⊃(⋅(MMI : 26)|-:⊙⋅∘)
 Decode   ← ⍜(-@a▽|Decrypt)⌵±. ▽≠@\s. ⊃(⊙Validate|⋅∘)
diff --git a/exercises/practice/affine-cipher/tests.ua b/exercises/practice/affine-cipher/tests.ua
@@ -25,7 +25,7 @@
 ⍤⤙≍ "swxtj npvyk lruol iejdc blaxk swxmh qzglf" Encode "The quick brown fox jumps over the lazy dog." 17 33
 
 # encode with a not coprime to m
-⍤⤙≍ "a and m must be coprime" ⍣(Encode "This is a test." 6 17)
+⍤⤙≍ "a and m must be coprime" ⍣(Encode "This is a test." 6 17|∘)
 
 # decode exercism
 ⍤⤙≍ "exercism" Decode "tytgn fjr" 3 7
@@ -46,4 +46,4 @@
 ⍤⤙≍ "jollygreengiant" Decode "vszzm    cly   yd cg    qdp" 15 16
 
 # decode with a not coprime to m
-⍤⤙≍ "a and m must be coprime" ⍣(Decode "Test" 13 5)
+⍤⤙≍ "a and m must be coprime" ⍣(Decode "Test" 13 5|∘)
diff --git a/exercises/practice/all-your-base/.meta/example.ua b/exercises/practice/all-your-base/.meta/example.ua
@@ -5,5 +5,5 @@ ValidBases ← (
 ValidDigits ← ⍤"all digits must satisfy 0 <= d < input base" /×↧⊃(≥0|<:)
 Valid       ← ⊃(ValidDigits|⋅ValidBases)
 FromInput   ← /+×ⁿ:⊙(⇌°⊏):
-ToOutput    ← ⨬([0]|◿:⌊÷⊸⊃(ⁿ⊙⋅∘|⋅∘)◡(⇌⇡+1⌊ₙ:))±.
+ToOutput    ← ⨬([0]|◿:⌊÷⊸⊃(ⁿ⊙⋅∘|⋅∘)◡(⇌⇡+1⌊⌝˜ⁿ:))±.
 Rebase      ← ToOutput FromInput ◡Valid
diff --git a/exercises/practice/all-your-base/tests.ua b/exercises/practice/all-your-base/tests.ua
@@ -88,52 +88,52 @@ Expected   ← [4 2]
 Digits     ← [0]
 InputBase  ← 1
 OutputBase ← 10
-⍤⤙≍ "input base must be >= 2" ⍣(Rebase Digits InputBase OutputBase)
+⍤⤙≍ "input base must be >= 2" ⍣(Rebase Digits InputBase OutputBase|∘)
 
 # Input base is zero
 Digits     ← []
 InputBase  ← 0
 OutputBase ← 10
-⍤⤙≍ "input base must be >= 2" ⍣(Rebase Digits InputBase OutputBase)
+⍤⤙≍ "input base must be >= 2" ⍣(Rebase Digits InputBase OutputBase|∘)
 
 # Input base is negative
 Digits     ← [1]
 InputBase  ← ¯2
 OutputBase ← 10
-⍤⤙≍ "input base must be >= 2" ⍣(Rebase Digits InputBase OutputBase)
+⍤⤙≍ "input base must be >= 2" ⍣(Rebase Digits InputBase OutputBase|∘)
 
 # Negative digit
 Digits     ← [1 ¯1 1 0 1 0]
 InputBase  ← 2
 OutputBase ← 10
-⍤⤙≍ "all digits must satisfy 0 <= d < input base" ⍣(Rebase Digits InputBase OutputBase)
+⍤⤙≍ "all digits must satisfy 0 <= d < input base" ⍣(Rebase Digits InputBase OutputBase|∘)
 
 # Invalid positive digit
 Digits     ← [1 2 1 0 1 0]
 InputBase  ← 2
 OutputBase ← 10
-⍤⤙≍ "all digits must satisfy 0 <= d < input base" ⍣(Rebase Digits InputBase OutputBase)
+⍤⤙≍ "all digits must satisfy 0 <= d < input base" ⍣(Rebase Digits InputBase OutputBase|∘)
 
 # Output base is one
 Digits     ← [1 0 1 0 1 0]
 InputBase  ← 2
 OutputBase ← 1
-⍤⤙≍ "output base must be >= 2" ⍣(Rebase Digits InputBase OutputBase)
+⍤⤙≍ "output base must be >= 2" ⍣(Rebase Digits InputBase OutputBase|∘)
 
 # Output base is zero
 Digits     ← [7]
 InputBase  ← 10
 OutputBase ← 0
-⍤⤙≍ "output base must be >= 2" ⍣(Rebase Digits InputBase OutputBase)
+⍤⤙≍ "output base must be >= 2" ⍣(Rebase Digits InputBase OutputBase|∘)
 
 # Output base is negative
 Digits     ← [1]
 InputBase  ← 2
 OutputBase ← ¯7
-⍤⤙≍ "output base must be >= 2" ⍣(Rebase Digits InputBase OutputBase)
+⍤⤙≍ "output base must be >= 2" ⍣(Rebase Digits InputBase OutputBase|∘)
 
 # Both bases are negative
 Digits     ← [1]
 InputBase  ← ¯2
 OutputBase ← ¯7
-⍤⤙≍ "input base must be >= 2" ⍣(Rebase Digits InputBase OutputBase)
+⍤⤙≍ "input base must be >= 2" ⍣(Rebase Digits InputBase OutputBase|∘)
diff --git a/exercises/practice/anagram/.meta/example.ua b/exercises/practice/anagram/.meta/example.ua
@@ -3,4 +3,4 @@ FilterSelf  ← |2 ▽≠⊙(¯⌵.)(¯⌵□)
 GetAnagrams ← |3 ▽=⊙□
 Sort        ← |1 ⍆¯⌵
 # Anagrams ? Target Words
-FindAnagrams ← |2 FilterSelf : GetAnagrams≡(□Sort°□):Sort:⤙⊙:.
+FindAnagrams ← |2 FilterSelf : GetAnagrams≡(□Sort°□):Sort :⤙⊙:.
diff --git a/exercises/practice/atbash-cipher/.meta/example.ua b/exercises/practice/atbash-cipher/.meta/example.ua
@@ -4,6 +4,6 @@ Alnum     ← ⊂Letters Digits
 Reversed  ← ⊂⇌Letters Digits
 Sanitize  ← ▽∊Alnum.
 Groups    ← ⊜(□∘)\+=0◿5°⊏
-Translate ← ⊏ ⟜Reversed ⊗ ⟜Alnum Sanitize ¯⌵
+Translate ← ⊏ ⟜Reversed ˜⨂ ⟜Alnum Sanitize ¯⌵
 Encode    ← /$"_ _" Groups Translate
 Decode    ← Translate Sanitize
diff --git a/exercises/practice/change/tests.ua b/exercises/practice/change/tests.ua
@@ -57,14 +57,14 @@ Expected ← []
 # Error testing for change smaller than the smallest of coins
 Coins  ← [5 10]
 Target ← 3
-⍤⤙≍ "can't make target with given coins" ⍣(Change Coins Target)
+⍤⤙≍ "can't make target with given coins" ⍣(Change Coins Target|∘)
 
 # Error if no combination can add up to target
 Coins  ← [5 10]
 Target ← 94
-⍤⤙≍ "can't make target with given coins" ⍣(Change Coins Target)
+⍤⤙≍ "can't make target with given coins" ⍣(Change Coins Target|∘)
 
 # Cannot find negative change values
 Coins  ← [1 2 5]
 Target ← ¯5
-⍤⤙≍ "target can't be negative" ⍣(Change Coins Target)
+⍤⤙≍ "target can't be negative" ⍣(Change Coins Target|∘)
diff --git a/exercises/practice/collatz-conjecture/tests.ua b/exercises/practice/collatz-conjecture/tests.ua
@@ -10,7 +10,7 @@
 ⍤⤙≍ 4 Steps 16
 
 # zero is an error
-⍤⤙≍ "only positive integers are allowed" ⍣(Steps 0)
+⍤⤙≍ "only positive integers are allowed" ⍣(Steps 0|∘)
 
 # negative value is an error
-⍤⤙≍ "only positive integers are allowed" ⍣(Steps ¯15)
+⍤⤙≍ "only positive integers are allowed" ⍣(Steps ¯15|∘)
diff --git a/exercises/practice/darts/.meta/example.ua b/exercises/practice/darts/.meta/example.ua
@@ -1,2 +1,2 @@
 Distance ← |2 √+∩(×.)
-Score    ← |2 ⊡ : 10_5_1_0 ⊗ 1 ≤ 1_5_10_∞ Distance
+Score    ← |2 ⊡ : 10_5_1_0 ˜⨂ 1 ≤ 1_5_10_∞ Distance
diff --git a/exercises/practice/dnd-character/.meta/example.ua b/exercises/practice/dnd-character/.meta/example.ua
@@ -7,4 +7,4 @@ Constitution ← °□⊡2
 Intelligence ← °□⊡3
 Wisdom       ← °□⊡4
 Charisma     ← °□⊡5
-Hitpoints    ← +10 Modifier ⊃Constitution
+Hitpoints    ← +10 Modifier Constitution
diff --git a/exercises/practice/flower-field/tests.ua b/exercises/practice/flower-field/tests.ua
@@ -1,8 +1,8 @@
 ~ "flower-field.ua" ~ Annotate
 
 # No rows
-Garden ← ""
-Expected  ← ""
+Garden   ← ""
+Expected ← ""
 ⍤⤙≍ Expected Annotate Garden
 
 # No columns

diff --git a/exercises/practice/forth/.meta/example.ua b/exercises/practice/forth/.meta/example.ua
@@ -1,6 +1,6 @@
 ! ↚ ⋅⍜↙₂/^0
 F ↚ (
-  ⊜(⤚⊗:{"DUP""DROP""SWAP""OVER""+""-""*""/"}□)⊸≠@ ⌵⊙[]
+  ⊜(⤚˜⨂:{"DUP""DROP""SWAP""OVER""+""-""*""/"}□)⊸≠@ ⌵⊙[]
   ⇌∧⨬(
     ⊂⊸⊢◌
   | ↘₁⍤.>₀⊸⧻◌
@@ -16,7 +16,7 @@ F ↚ (
 Evaluate ← (
   ⍣(<∞⊸/↥F
   | ▽⊜⍣(1⋕)∩0⊸≠@ ◌
-    1⨬"empty stack""only one value on the stack"≍1⍣⊣
+    1⨬"empty stack""only one value on the stack"≍1⍣⊣∘
   )
   ⍤"divide by zero"
 )
diff --git a/exercises/practice/forth/tests.ua b/exercises/practice/forth/tests.ua
@@ -10,28 +10,28 @@
 ⍤⤙≍ [3] Evaluate "1 2 +"
 
 # Addition - errors if there is nothing on the stack
-⍤⤙≍ "empty stack" ⍣(Evaluate "+")
+⍤⤙≍ "empty stack" ⍣(Evaluate "+"|∘)
 
 # Addition - errors if there is only one value on the stack
-⍤⤙≍ "only one value on the stack" ⍣(Evaluate "1 +")
+⍤⤙≍ "only one value on the stack" ⍣(Evaluate "1 +"|∘)
 
 # Subtraction - can subtract two numbers
 ⍤⤙≍ [¯1] Evaluate "3 4 -"
 
 # Subtraction - errors if there is nothing on the stack
-⍤⤙≍ "empty stack" ⍣(Evaluate "-")
+⍤⤙≍ "empty stack" ⍣(Evaluate "-"|∘)
 
 # Subtraction - errors if there is only one value on the stack
-⍤⤙≍ "only one value on the stack" ⍣(Evaluate "1 -")
+⍤⤙≍ "only one value on the stack" ⍣(Evaluate "1 -"|∘)
 
 # Multiplication - can multiply two numbers
 ⍤⤙≍ [8] Evaluate "2 4 *"
 
 # Multiplication - errors if there is nothing on the stack
-⍤⤙≍ "empty stack" ⍣(Evaluate "*")
+⍤⤙≍ "empty stack" ⍣(Evaluate "*"|∘)
 
 # Multiplication - errors if there is only one value on the stack
-⍤⤙≍ "only one value on the stack" ⍣(Evaluate "1 *")
+⍤⤙≍ "only one value on the stack" ⍣(Evaluate "1 *"|∘)
 
 # Division - can divide two numbers
 ⍤⤙≍ [4] Evaluate "12 3 /"
@@ -40,13 +40,13 @@
 ⍤⤙≍ [2] Evaluate "8 3 /"
 
 # Division - errors if dividing by zero
-⍤⤙≍ "divide by zero" ⍣(Evaluate "4 0 /")
+⍤⤙≍ "divide by zero" ⍣(Evaluate "4 0 /"|∘)
 
 # Division - errors if there is nothing on the stack
-⍤⤙≍ "empty stack" ⍣(Evaluate "/")
+⍤⤙≍ "empty stack" ⍣(Evaluate "/"|∘)
 
 # Division - errors if there is only one value on the stack
-⍤⤙≍ "only one value on the stack" ⍣(Evaluate "1 /")
+⍤⤙≍ "only one value on the stack" ⍣(Evaluate "1 /"|∘)
 
 # Combined arithmetic - addition and subtraction
 ⍤⤙≍ [¯1] Evaluate "1 2 + 4 -"
@@ -61,7 +61,7 @@
 ⍤⤙≍ [1 2 2] Evaluate "1 2 dup"
 
 # Dup - errors if there is nothing on the stack
-⍤⤙≍ "empty stack" ⍣(Evaluate "dup")
+⍤⤙≍ "empty stack" ⍣(Evaluate "dup"|∘)
 
 # Drop - removes the top value on the stack if it is the only one
 ⍤⤙≍ [] Evaluate "1 drop"
@@ -70,7 +70,7 @@
 ⍤⤙≍ [1] Evaluate "1 2 drop"
 
 # Drop - errors if there is nothing on the stack
-⍤⤙≍ "empty stack" ⍣(Evaluate "drop")
+⍤⤙≍ "empty stack" ⍣(Evaluate "drop"|∘)
 
 # Swap - swaps the top two values on the stack if they are the only ones
 ⍤⤙≍ [2 1] Evaluate "1 2 swap"
@@ -79,10 +79,10 @@
 ⍤⤙≍ [1 3 2] Evaluate "1 2 3 swap"
 
 # Swap - errors if there is nothing on the stack
-⍤⤙≍ "empty stack" ⍣(Evaluate "swap")
+⍤⤙≍ "empty stack" ⍣(Evaluate "swap"|∘)
 
 # Swap - errors if there is only one value on the stack
-⍤⤙≍ "only one value on the stack" ⍣(Evaluate "1 swap")
+⍤⤙≍ "only one value on the stack" ⍣(Evaluate "1 swap"|∘)
 
 # Over - copies the second element if there are only two
 ⍤⤙≍ [1 2 1] Evaluate "1 2 over"
@@ -91,10 +91,10 @@
 ⍤⤙≍ [1 2 3 2] Evaluate "1 2 3 over"
 
 # Over - errors if there is nothing on the stack
-⍤⤙≍ "empty stack" ⍣(Evaluate "over")
+⍤⤙≍ "empty stack" ⍣(Evaluate "over"|∘)
 
 # Over - errors if there is only one value on the stack
-⍤⤙≍ "only one value on the stack" ⍣(Evaluate "1 over")
+⍤⤙≍ "only one value on the stack" ⍣(Evaluate "1 over"|∘)
 
 # Case-insensitivity - DUP is case-insensitive
 ⍤⤙≍ [1 1 1 1] Evaluate "1 DUP Dup dup"

diff --git a/exercises/practice/grains/tests.ua b/exercises/practice/grains/tests.ua
@@ -19,16 +19,16 @@
 ⍤⤙≍ 2147483648 Square 32
 
 # grains on square 64?
-⍤⤙≍ 9223372036854775808 Square 64
+⍤⤙≍ 9223372036854776000 Square 64
 
 # square greater than 64 is invalid
-⍤⤙≍ "square must be between 1 and 64" ⍣(Square 65)
+⍤⤙≍ "square must be between 1 and 64" ⍣(Square 65|∘)
 
 # square 0 is invalid
-⍤⤙≍ "square must be between 1 and 64" ⍣(Square 0)
+⍤⤙≍ "square must be between 1 and 64" ⍣(Square 0|∘)
 
 # negative square is invali
-⍤⤙≍ "square must be between 1 and 64" ⍣(Square `1)
+⍤⤙≍ "square must be between 1 and 64" ⍣(Square ¯1|∘)
 
 # returns the total number of grains on the board
-⍤⤙≍ 18446744073709551615 Total
+⍤⤙≍ 18446744073709552000 Total
diff --git a/exercises/practice/hamming/tests.ua b/exercises/practice/hamming/tests.ua
@@ -16,13 +16,13 @@
 ⍤⤙≍ 9 Distance "GGACGGATTCTG" "AGGACGGATTCT"
 
 # disallow empty first strand
-⍤⤙≍ "strands must be of equal length" ⍣(Distance "" "G")
+⍤⤙≍ "strands must be of equal length" ⍣(Distance "" "G"|∘)
 
 # disallow empty second strand
-⍤⤙≍ "strands must be of equal length" ⍣(Distance "G" "")
+⍤⤙≍ "strands must be of equal length" ⍣(Distance "G" ""|∘)
 
 # disallow first strand longer
-⍤⤙≍ "strands must be of equal length" ⍣(Distance "AATG" "AAA")
+⍤⤙≍ "strands must be of equal length" ⍣(Distance "AATG" "AAA"|∘)
 
 # disallow second strand longer
-⍤⤙≍ "strands must be of equal length" ⍣(Distance "ATA" "AGTG")
+⍤⤙≍ "strands must be of equal length" ⍣(Distance "ATA" "AGTG"|∘)
diff --git a/exercises/practice/intergalactic-transmission/tests.ua b/exercises/practice/intergalactic-transmission/tests.ua
@@ -82,11 +82,11 @@ Expected ← [41]
 
 # first byte has wrong parity
 Message ← [7 0]
-⍤⤙≍ "wrong parity" ⍣(DecodeMessage Message)
+⍤⤙≍ "wrong parity" ⍣(DecodeMessage Message|∘)
 
 # second byte has wrong parity
 Message ← [3 104]
-⍤⤙≍ "wrong parity" ⍣(DecodeMessage Message)
+⍤⤙≍ "wrong parity" ⍣(DecodeMessage Message|∘)
 
 # 0xcf4b00 is decoded to 0xce94
 Message  ← [207 75 0]
@@ -110,7 +110,7 @@ Expected ← [71 114 101 97 116 49 33]
 
 # last byte has wrong parity
 Message ← [71 184 153 172 23 160 197 67]
-⍤⤙≍ "wrong parity" ⍣(DecodeMessage Message)
+⍤⤙≍ "wrong parity" ⍣(DecodeMessage Message|∘)
 
 # eight byte message
 Message  ← [192 0 68 102 125 6 120 66 33 129]
@@ -124,4 +124,4 @@ Expected ← [69 120 101 114 99 105 115 109 32 105 115 32 97 119 101 115 111 109
 
 # wrong parity on 16th byte
 Message ← [68 189 24 175 39 27 165 231 108 144 27 46 51 3 132 239 101 184 219 237 215 40 132]
-⍤⤙≍ "wrong parity" ⍣(DecodeMessage Message)
+⍤⤙≍ "wrong parity" ⍣(DecodeMessage Message|∘)
diff --git a/exercises/practice/largest-series-product/tests.ua b/exercises/practice/largest-series-product/tests.ua
@@ -28,7 +28,7 @@
 ⍤⤙≍ 0 LargestProduct "99099" 3
 
 # rejects span longer than string length
-⍤⤙≍ "span must be smaller than string length" ⍣(LargestProduct "123" 4)
+⍤⤙≍ "span must be smaller than string length" ⍣(LargestProduct "123" 4|∘)
 
 # reports 1 for empty string and empty product (0-span)
 ⍤⤙≍ 1 LargestProduct "" 0
@@ -37,10 +37,10 @@
 ⍤⤙≍ 1 LargestProduct "123" 0
 
 # rejects empty string and nonzero span
-⍤⤙≍ "span must be smaller than string length" ⍣(LargestProduct "" 1)
+⍤⤙≍ "span must be smaller than string length" ⍣(LargestProduct "" 1|∘)
 
 # rejects invalid character in digits
-⍤⤙≍ "invalid character in digits" ⍣(LargestProduct "1234a5" 2)
+⍤⤙≍ "invalid character in digits" ⍣(LargestProduct "1234a5" 2|∘)
 
 # rejects negative span
-⍤⤙≍ "span must not be negative" ⍣(LargestProduct "12345" ¯1)
+⍤⤙≍ "span must not be negative" ⍣(LargestProduct "12345" ¯1|∘)
diff --git a/exercises/practice/nth-prime/tests.ua b/exercises/practice/nth-prime/tests.ua
@@ -13,4 +13,4 @@
 ⍤⤙≍ 104743 Prime 10001
 
 # There is no zeroth prime
-⍤⤙≍ "there is no zeroth prime" ⍣(Prime 0)
+⍤⤙≍ "there is no zeroth prime" ⍣(Prime 0|∘)
diff --git a/exercises/practice/nucleotide-count/tests.ua b/exercises/practice/nucleotide-count/tests.ua
@@ -13,4 +13,4 @@
 ⍤⤙≍ map "ACGT" 20_12_17_21 NucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
 
 # strand with invalid nucleotides
-⍤⤙≍ "invalid nucleotide in strand" ⍣(NucleotideCounts "AGXXACT")
+⍤⤙≍ "invalid nucleotide in strand" ⍣(NucleotideCounts "AGXXACT"|∘)